circad | circRNAs associated with diseases

circRNA_13478
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Pulmonary Tuberculosis	ICD-10	Respiratory tuberculosis, bacteriologically and histologically confirmed (A15)
DBLink	Link to database	PMID	29371930
Experimental Method
Sample Type	Blood samples	Comparison	Fasting whole blood samples were collected from the Pulmonary Tuberculosis (PTB) patients and healthy individuals
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TTTGGAGTTCTTCCCTGGG Reverse GATGAGCTCAGCTTTGAACAG	Statistics	Fold Change : Downregulated,0.100383739 pvalue : p<0.05
Citation
Zhang, X, Zhu, M, Yang, R, Zhao, W, Hu, X, Gan, J (2017). Identification and comparison of novel circular RNAs with associated co-expression and competing endogenous RNA networks in pulmonary tuberculosis. Oncotarget, 8, 69:113571-113582.